Review



yellow nano lantern  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc yellow nano lantern
    Yellow Nano Lantern, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pm41507351-169-6-8?v=Addgene+inc
    Average 94 stars, based on 3 article reviews
    yellow nano lantern - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    yellow nano lantern  (Addgene inc)
    94
    Addgene inc yellow nano lantern
    Yellow Nano Lantern, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pm41507351-169-6-8?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    yellow nano lantern - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    nano lantern prsetb plasmid  (Addgene inc)
    90
    Addgene inc nano lantern prsetb plasmid
    Nano Lantern Prsetb Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pm35739310-492-1-4?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    nano lantern prsetb plasmid - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    nano-lantern prsetb plasmid 51969  (Nagai Nori USA INC)
    90
    Nagai Nori USA INC nano-lantern prsetb plasmid 51969
    Nano Lantern Prsetb Plasmid 51969, supplied by Nagai Nori USA INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pm35739310-492-1-12?v=Nagai+Nori+USA+INC
    Average 90 stars, based on 1 article reviews
    nano-lantern prsetb plasmid 51969 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    red enhanced nano lantern  (Addgene inc)
    93
    Addgene inc red enhanced nano lantern
    Red Enhanced Nano Lantern, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pmc08953635-32-16-22?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    red enhanced nano lantern - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    nano lantern camp 1 6  (Addgene inc)
    94
    Addgene inc nano lantern camp 1 6
    Nano Lantern Camp 1 6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/10__3390_slash_app10217646-76-15-16?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    nano lantern camp 1 6 - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    ggcgaattcggtacccccagcagctgttac  (Addgene inc)
    94
    Addgene inc ggcgaattcggtacccccagcagctgttac
    Ggcgaattcggtacccccagcagctgttac, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/10__3390_slash_app10217646-76-13-16?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    ggcgaattcggtacccccagcagctgttac - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    prsetb nano lantern plasmid  (Addgene inc)
    86
    Addgene inc prsetb nano lantern plasmid
    Prsetb Nano Lantern Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nano+lantern+prsetb+plasmid/pm29466657__cb7b01019_si_001-19-1-9?v=Addgene+inc
    Average 86 stars, based on 1 article reviews
    prsetb nano lantern plasmid - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier

    Image Search Results